Journal: iScience

Article Title: Inhibition of HIV-1 replication by nanobodies targeting tetraspanin CD9

doi: 10.1016/j.isci.2024.110958

Figure Lengend Snippet:

Article Snippet: Nanobodies were produced in E. coli Rosetta 2 (DE3) BL21 cells (Merck) and purified using Ni-NTA as described previously.

Techniques: Virus, Recombinant, Enzyme-linked Immunosorbent Assay, Plasmid Preparation, Derivative Assay, Software, Expressing, Mutagenesis

Journal: STAR Protocols

Article Title: Protocol for producing brain-derived neurotrophic factor and neurotrophin-4 in their pro and active form in Escherichia coli

doi: 10.1016/j.xpro.2025.103715

Figure Lengend Snippet:

Article Snippet: BL21 (DE3) Rosetta 2 E coli , Merck Millipore , Cat#71400.

Techniques: Virus, Recombinant, Plasmid Preparation, Gel Extraction, Software, Membrane, DNA Purification

Journal: Nature Communications

Article Title: Shared active site architecture between archaeal PolD and multi-subunit RNA polymerases revealed by X-ray crystallography

doi: 10.1038/ncomms12227

Figure Lengend Snippet: ( a ) Overview of the conserved ‘two-barrel' catalytic core in PolD DP2, S. cerevisiae RNAP-II (PDBid: 4BBS (ref. )) and Neurospora crassa QDE-1 (PDBid: 2J7O (ref. )). ( b ) Superposition of the DPBB subdomains of PolD (blue) and S. cerevisiae RNAP-II (pink). Left: the PolD DPBB-II subdomain is superimposed on the RNAP-II DPBB-A subdomain (Cα r.m.s.d. of 1.72 Å calculated over 73 residues). Cα of the catalytic aspartate residues are shown as spheres. Right: the PolD DPBB-I subdomain is superimposed on the RNAP-II DPBB-B subdomain (Cα r.m.s.d. of 2.21 Å calculated over 42 residues). ( c ) Possible evolutionary relationship between the DNA-dependent DNAP PolD, DNA-dependent RNAPs and RNA-dependent RNAPs. Conserved catalytic motifs are highlighted in a multi-sequence alignment. The alignment was generated using representative protein with a large sequence diversity to illustrate sequence variability (GI accession number): (i) for RNA-dependent RNAPs Caenorhabditis elegans (392,886,219), Arabidopsis thaliana (42,569,168) and N. crassa (85,091,735); (ii) for DNA-dependent RNAPs Homo sapiens (4,096,591; 119,610,588; 20,159,751), Pyrococcus abyssi (499,169,463) and Escherichia coli (983,454,941); and (iii) for D-family DNAPs P. abyssi (504,648,395), Thermococcus nautili (757,137,858), Haloferax volcanii (490,144,762), Korarchaeum cryptofilum (501,267,152) and Methanosarcina mazei (814,797,709).

Article Snippet: The protein was expressed by 1 mM isopropyl- D -thiogalactoside induction in E. coli strain BL21(DE3) Rosetta2 grown overnight in LB (Lysogeny Broth) at 20 °C and purified by Ni-NTA and heparin chromatography (GE Healthcare), followed by TEV cleavage of the tag and size-exclusion chromatography.

Techniques: Sequencing, Generated

Journal: Nature Communications

Article Title: Shared active site architecture between archaeal PolD and multi-subunit RNA polymerases revealed by X-ray crystallography

doi: 10.1038/ncomms12227

Figure Lengend Snippet: The following crystal structures were used: Polβ from Rattus norvegicus (PDBid: 1BPB), Pol III from Escherichia coli (PDBid: 2HNH), Polι from Homo sapiens (PDBid: 1T3N), PolB from Enterobacteria phage RB69 (PDBid: 1IH7), Pol I from E. coli (PDBid: 1KLN), RNAP β′ subunit from E. coli (PDBid: 4MEX) and PolD from P. abyssi (this study).

Article Snippet: The protein was expressed by 1 mM isopropyl- D -thiogalactoside induction in E. coli strain BL21(DE3) Rosetta2 grown overnight in LB (Lysogeny Broth) at 20 °C and purified by Ni-NTA and heparin chromatography (GE Healthcare), followed by TEV cleavage of the tag and size-exclusion chromatography.

Techniques:

Journal: Structure (London, England : 1993)

Article Title: Molecular basis for the PZP domain of BRPF1 association with chromatin

doi: 10.1016/j.str.2019.10.014

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Software used in this this study has been previously published as detailed in the . table ft1 table-wrap mode="anchored" t5 caption a7 REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains Escherichia coli Rosetta-2 (DE3) pLysS Novagen-Thermo Fisher Sci 71-401-3 Escherichia coli BL21 DE3 pLysS Promega L1195 Chemicals, Peptides, and Recombinant Proteins Dithiothreitol Gold Biotechnology 27565-41-9 15NH4Cl Sigma-Aldrich 299251 IPTG Gold biotechnology I2481C100 Glutatahione Sepharose 4B beads Thermo Fisher Sci 16101 H3 peptides (1–12aa, 15–34aa, and 1–31aa) Synpeptide N/A Tobacco etch virus (TEV) protease van den Berg et al., 2006 N/A Deposited Data Protein Data Bank This study PDB ID 6U04 Protein Data Bank Klein et al., 2016 PDB ID 5ERC Oligonucleotides Primer: D294K Forward: aatgtcatcctcttctgtaagatgtgcaacctggccgtg This study - IDT N/A Primer: D294K Reverse: cacggccaggttgcacatcttacagaagaggatgacatt This study - IDT N/A Primer: KKR Forward: caccagctcgctgggaactcacctgctac This study - IDT N/A Primer: KKR Forward: acctgctacatttgcgaacaagagggctcaggggcctgcatccagtgc This study - IDT N/A Primer: KKR Reverse: gtagcaggtgagttcccagcgagctggtg This study - IDT N/A Primer: KKR Reverse: gcactggatgcaggcccctgagccctcttgttcgcaaatgtagcaggt This study - IDT N/A Recombinant DNA Plasmid: pDEST15 Thermo Fisher Sci 1180214 Software and Algorithms HKL3000 Minor et al., 2006 Phenix Adams et al., 2010 N/A Coot Emsley et al., 2010 N/A MOLProbity Chen et al., 2010 N/A Open in a separate window KEY RESOURCES TABLE

Techniques: Virus, Recombinant, Plasmid Preparation, Software